@Test
public void testParse() throws Exception {
// generate a sample JSON array
StringBuilder sample = new StringBuilder();
sample.append("[");
int i = 0;
final int N = 5000;
for (; i < N; i++) {
sample.append(i);
sample.append(",");
}
sample.append(i);
sample.append("]");
String json = sample.toString();
StopWatch timer = new StopWatch();
for (int n = 0; n < 500; n++) {
JSONPullParser parser = new JSONPullParser(json);
JSONEvent e;
while ((e = parser.next()) != JSONEvent.EndJSON) {}
}
_logger.info("time: " + timer.getElapsedTime());
}
public class DTDParserTest {
Logger _logger = Logger.getLogger(DTDParserTest.class);
@Before
public void setUp() throws Exception {}
@After
public void tearDown() throws Exception {}
@Test
public void parse() throws IOException, RecognitionException {
DTDParser parser =
DTDParserUtil.createParser(
FileResource.find(DTDParserTest.class, "auction.dtd").openStream());
DTDParser.dtd_return r = parser.dtd();
CommonTree t = (CommonTree) r.getTree();
_logger.debug(ANTLRUtil.parseTree(t, DTDParser.tokenNames));
}
@Test
public void parseLine() throws IOException, RecognitionException {
DTDParser parser =
DTDParserUtil.createParser(
FileResource.find(DTDParserTest.class, "simple.dtd").openStream());
DTDParser.dtd_return r = parser.dtd();
CommonTree t = (CommonTree) r.getTree();
_logger.debug(ANTLRUtil.parseTree(t, DTDParser.tokenNames));
}
}
public Alignment bandedAlign(String ref, String query) throws Exception {
ACGTSequence r = new ACGTSequence(ref);
ACGTSequence q = new ACGTSequence(query);
Alignment alignment = SmithWatermanAligner.bandedAlign(r, q);
_logger.debug(alignment);
return alignment;
}
@Test
public void testLexerPerformance() throws Exception {
// generate a sample JSON array
StringBuilder sample = new StringBuilder();
sample.append("[");
int i = 0;
final int N = 5000;
for (; i < N; i++) {
sample.append(i);
sample.append(",");
}
sample.append(i);
sample.append("]");
String json = sample.toString();
StopWatch timer = new StopWatch();
for (int n = 0; n < 500; n++) {
JSONLexer lexer = new JSONLexer(json);
Token t;
while ((t = lexer.nextToken()) != null) {}
}
_logger.info("time: " + timer.getElapsedTime());
}
@Test
public void scan() throws Exception {
ACGTSequence q =
new ACGTSequence(
"TTTATACGTGTTTGAATAACTTGGCCAAATCGCCGAGAAGGAATAGAATACTGGACGACATTGTACATATTTTCCAAAAAATCAGAAAGTAGATGACGGG");
PrefixScan scan =
PrefixScan.scanRead(fmIndex, q, Strand.FORWARD, new StaircaseFilter(q.length(), 7));
_logger.debug(scan);
}
@Test
public void parseLine() throws IOException, RecognitionException {
DTDParser parser =
DTDParserUtil.createParser(
FileResource.find(DTDParserTest.class, "simple.dtd").openStream());
DTDParser.dtd_return r = parser.dtd();
CommonTree t = (CommonTree) r.getTree();
_logger.debug(ANTLRUtil.parseTree(t, DTDParser.tokenNames));
}
public static void main(String[] args) throws OptionParserException, IOException {
Config config = new Config();
OptionParser optionParser = new OptionParser(config);
optionParser.parse(args);
if (config.displayHelp) {
optionParser.printUsage();
}
if (config.verbose) {
Logger.getRootLogger().setLogLevel(LogLevel.ALL);
}
if (config.searchFolderName == null) {
System.err.println("no search folder is specified");
return;
}
_logger.debug("search folder = " + config.searchFolderName);
if (config.packageName == null || config.className == null) {
System.err.println("no package or class name is given");
return;
}
// search track classes
File searchFolder = new File(config.searchFolderName);
TrackResourceFinder finder = new TrackResourceFinder(searchFolder);
finder.enter(searchFolder);
// template
Template template =
new Template(
FileResource.find(TrackLoaderGenerator.class, "TrackLoader.java.template")
.openStream());
Properties p = new Properties();
p.put("trackClasses", finder.trackClassFile);
p.put("trackGroupClasses", finder.trackGroupClassFile);
p.put("packageName", config.packageName);
p.put("className", config.className);
String result = template.apply(p);
System.out.print(result);
}
public void enter(File directory) {
assert (directory.isDirectory());
_logger.trace("enter the directory: " + directory.getName());
File[] fileList = directory.listFiles();
for (File file : fileList) {
if (file.isDirectory()) {
enter(file);
} else {
if (file.getName().endsWith("Track.class") && !file.getName().equals("Track.class")) {
String className = getClassName(file);
_logger.trace("found a track class: " + className);
trackClassFile.add(className);
}
if (file.getName().endsWith("TrackGroup.class")) {
String className = getClassName(file);
_logger.trace("found a track group class: " + className);
trackGroupClassFile.add(className);
}
}
}
}
HashedArrayList<String, String> parse(String file) throws Exception {
JSONStreamReader reader =
new JSONStreamReader(FileResource.open(JSONStreamReaderTest.class, file));
TreeEvent e;
HashedArrayList<String, String> data = new HashedArrayList<String, String>();
while ((e = reader.next()) != null) {
_logger.debug(e);
if (e.isVisit()) data.put(e.nodeName, e.nodeValue);
}
return data;
}
public class PrefixScanTest {
private static Logger _logger = Logger.getLogger(PrefixScanTest.class);
private FMIndexOnGenome fmIndex;
@Before
public void setUp() throws Exception {
PackedFASTA fasta =
PackFasta.encode(new FASTAPullParser(FileResource.open(PackFastaTest.class, "sample2.fa")));
fmIndex = FMIndexOnGenome.buildFromSequence("sample", fasta.sequence);
}
@Test
public void scan() throws Exception {
ACGTSequence q =
new ACGTSequence(
"TTTATACGTGTTTGAATAACTTGGCCAAATCGCCGAGAAGGAATAGAATACTGGACGACATTGTACATATTTTCCAAAAAATCAGAAAGTAGATGACGGG");
PrefixScan scan =
PrefixScan.scanRead(fmIndex, q, Strand.FORWARD, new StaircaseFilter(q.length(), 7));
_logger.debug(scan);
}
}
@Test
public void performanceOfCSVSplit() throws Exception {
StopWatch s = new StopWatch();
String line = null;
final int N = 1;
Pattern p = Pattern.compile(",");
s.reset();
for (int i = 0; i < N; i++) {
BufferedReader br =
new BufferedReader(
new InputStreamReader(
FileResource.find(SilkWalkerTest.class, "scaffold1.silk").openStream()));
while ((line = br.readLine()) != null) {
ArrayList<String> csv = StringUtil.splitCSV(line);
}
}
_logger.info("OpenCSV split:" + s.getElapsedTime());
}
public class JSONStreamReaderTest {
private static Logger _logger = Logger.getLogger(JSONStreamReaderTest.class);
@Before
public void setUp() throws Exception {}
@After
public void tearDown() throws Exception {}
HashedArrayList<String, String> parse(String file) throws Exception {
JSONStreamReader reader =
new JSONStreamReader(FileResource.open(JSONStreamReaderTest.class, file));
TreeEvent e;
HashedArrayList<String, String> data = new HashedArrayList<String, String>();
while ((e = reader.next()) != null) {
_logger.debug(e);
if (e.isVisit()) data.put(e.nodeName, e.nodeValue);
}
return data;
}
@Test
public void testNext() throws Exception {
HashedArrayList<String, String> data = parse("sample.json");
assertEquals("Leo", data.get("name").get(0));
assertEquals("100", data.get("id").get(0));
}
@Test
public void testArray() throws Exception {
HashedArrayList<String, String> data = parse("array.json");
assertEquals(2, data.get("author").size());
assertEquals("leo", data.get("author").get(0));
assertEquals("yui", data.get("author").get(1));
assertEquals("Relational-Style XML Query", data.get("title").get(0));
assertNull(data.get("paper").get(0));
}
@Test
public void testParse() throws Exception {
// generate a sample JSON array
StringBuilder sample = new StringBuilder();
sample.append("[");
int i = 0;
final int N = 5000;
for (; i < N; i++) {
sample.append(i);
sample.append(",");
}
sample.append(i);
sample.append("]");
String json = sample.toString();
StopWatch timer = new StopWatch();
for (int n = 0; n < 500; n++) {
JSONPullParser parser = new JSONPullParser(json);
JSONEvent e;
while ((e = parser.next()) != JSONEvent.EndJSON) {}
}
_logger.info("time: " + timer.getElapsedTime());
}
@Test
public void testLexerPerformance() throws Exception {
// generate a sample JSON array
StringBuilder sample = new StringBuilder();
sample.append("[");
int i = 0;
final int N = 5000;
for (; i < N; i++) {
sample.append(i);
sample.append(",");
}
sample.append(i);
sample.append("]");
String json = sample.toString();
StopWatch timer = new StopWatch();
for (int n = 0; n < 500; n++) {
JSONLexer lexer = new JSONLexer(json);
Token t;
while ((t = lexer.nextToken()) != null) {}
}
_logger.info("time: " + timer.getElapsedTime());
}
}
public class TrackLoaderGenerator {
private static Logger _logger = Logger.getLogger(TrackLoaderGenerator.class);
@Usage(
command = "> java -cp bin org.utgenome.gwt.utgb.TrackLoaderGenerator [option] search_folder")
public static class Config {
@Option(symbol = "h", longName = "help", description = "display help messages")
boolean displayHelp = false;
@Option(symbol = "v", longName = "verbose", description = "display verbose messages")
boolean verbose = false;
@Option(symbol = "p", longName = "package", varName = "NAME", description = "package name")
String packageName = null;
@Option(symbol = "c", longName = "class", varName = "NAME", description = "class name")
String className = null;
@Argument String searchFolderName = null;
}
public static void main(String[] args) throws OptionParserException, IOException {
Config config = new Config();
OptionParser optionParser = new OptionParser(config);
optionParser.parse(args);
if (config.displayHelp) {
optionParser.printUsage();
}
if (config.verbose) {
Logger.getRootLogger().setLogLevel(LogLevel.ALL);
}
if (config.searchFolderName == null) {
System.err.println("no search folder is specified");
return;
}
_logger.debug("search folder = " + config.searchFolderName);
if (config.packageName == null || config.className == null) {
System.err.println("no package or class name is given");
return;
}
// search track classes
File searchFolder = new File(config.searchFolderName);
TrackResourceFinder finder = new TrackResourceFinder(searchFolder);
finder.enter(searchFolder);
// template
Template template =
new Template(
FileResource.find(TrackLoaderGenerator.class, "TrackLoader.java.template")
.openStream());
Properties p = new Properties();
p.put("trackClasses", finder.trackClassFile);
p.put("trackGroupClasses", finder.trackGroupClassFile);
p.put("packageName", config.packageName);
p.put("className", config.className);
String result = template.apply(p);
System.out.print(result);
}
static class TrackResourceFinder {
ArrayList<String> trackClassFile = new ArrayList<String>();
ArrayList<String> trackGroupClassFile = new ArrayList<String>();
File searchFolder;
public TrackResourceFinder(File searchFolder) {
if (!searchFolder.isDirectory())
throw new IllegalArgumentException(searchFolder.getName() + " is not a directory");
this.searchFolder = searchFolder;
}
private String getClassName(File classFile) {
String classFilePath =
classFile.getAbsolutePath().replace(searchFolder.getAbsolutePath() + File.separator, "");
return classFilePath.replace(File.separator, ".").replace(".class", "");
}
public void enter(File directory) {
assert (directory.isDirectory());
_logger.trace("enter the directory: " + directory.getName());
File[] fileList = directory.listFiles();
for (File file : fileList) {
if (file.isDirectory()) {
enter(file);
} else {
if (file.getName().endsWith("Track.class") && !file.getName().equals("Track.class")) {
String className = getClassName(file);
_logger.trace("found a track class: " + className);
trackClassFile.add(className);
}
if (file.getName().endsWith("TrackGroup.class")) {
String className = getClassName(file);
_logger.trace("found a track group class: " + className);
trackGroupClassFile.add(className);
}
}
}
}
}
}
@Test
public void perfTest() throws Exception {
StopWatch s = new StopWatch();
File in = FileResource.copyToTemp(SilkWalkerTest.class, "scaffold1.silk", new File("target"));
final int N = 2;
{
s.reset();
int lineCount = 0;
char[] buf = new char[8192];
for (int i = 0; i < N; i++) {
BufferedReader fb = new BufferedReader(new FileReader(in));
for (int readSize = 0; (readSize = fb.read(buf)) != -1; ) {
for (int c = 0; c < readSize; c++) {
if (buf[c] == '\r') {
lineCount++;
if (c + 1 < readSize && buf[c + 1] == '\n') {
c++;
}
} else if (buf[c] == '\n') {
lineCount++;
}
}
}
}
_logger.info(String.format("BufferedReader: %.2f", s.getElapsedTime()));
}
{
s.reset();
int lineCount = 0;
for (int i = 0; i < N; i++) {
BufferedScanner fb = new BufferedScanner(new FileInputStream(in));
for (CharSequence line; (line = fb.nextLine()) != null; lineCount++) {}
}
_logger.info(
String.format("BufferedScanner nextLine: %.2f, line:%d", s.getElapsedTime(), lineCount));
}
{
s.reset();
int lineCount = 0;
for (int i = 0; i < N; i++) {
BufferedReader fb = new BufferedReader(new FileReader(in));
for (String line; (line = fb.readLine()) != null; lineCount++) {}
}
_logger.info(
String.format("BufferedReader readLine: %.2f, line:%d", s.getElapsedTime(), lineCount));
}
{
s.reset();
int lineCount = 0;
for (int i = 0; i < N; i++) {
BufferedScanner fb = new BufferedScanner(new FileInputStream(in));
for (CharSequence line; (line = fb.nextLine()) != null; lineCount++) {
String st = line.toString();
}
}
_logger.info(
String.format(
"BufferedScanner nextLine (with String conversion): %.2f, line:%d",
s.getElapsedTime(), lineCount));
}
{
s.reset();
int lineCount = 0;
for (int i = 0; i < N; i++) {
BufferedScanner fb = new BufferedScanner(new FileReader(in));
for (CharSequence line; (line = fb.nextLine()) != null; lineCount++) {}
}
_logger.info(
String.format(
"BufferedScanner nextLine with Reader input: %.2f, line:%d",
s.getElapsedTime(), lineCount));
}
{
s.reset();
int lineCount = 0;
char[] buf = new char[8192];
for (int i = 0; i < N; i++) {
FastBufferedReader fb = new FastBufferedReader(new FileReader(in));
for (int readSize = 0; (readSize = fb.read(buf)) != -1; ) {
for (int c = 0; c < readSize; c++) {
if (buf[c] == '\r') {
lineCount++;
if (c + 1 < readSize && buf[c + 1] == '\n') {
c++;
}
} else if (buf[c] == '\n') {
lineCount++;
}
}
}
}
_logger.info(String.format("FastBufferedReader: %.2f", s.getElapsedTime()));
}
{
s.reset();
int lineCount = 0;
byte[] buf = new byte[8192];
for (int i = 0; i < N; i++) {
FastBufferedInputStream fb = new FastBufferedInputStream(new FileInputStream(in));
for (int readSize = 0; (readSize = fb.read(buf)) != -1; ) {
for (int c = 0; c < readSize; c++) {
if (buf[c] == '\r') {
lineCount++;
if (c + 1 < readSize && buf[c + 1] == '\n') {
c++;
}
} else if (buf[c] == '\n') {
lineCount++;
}
}
}
}
_logger.info(String.format("FastBufferedInputStream: %.2f", s.getElapsedTime()));
}
{
s.reset();
int lineCount = 0;
byte[] buf = new byte[8192];
for (int i = 0; i < N; i++) {
BufferedInputStream fb = new BufferedInputStream(new FileInputStream(in));
for (int readSize = 0; (readSize = fb.read(buf)) != -1; ) {
for (int c = 0; c < readSize; c++) {
if (buf[c] == '\r') {
lineCount++;
if (c + 1 < readSize && buf[c + 1] == '\n') {
c++;
}
} else if (buf[c] == '\n') {
lineCount++;
}
}
}
}
_logger.info(String.format("BufferedInputStream: %.2f", s.getElapsedTime()));
}
}
public class FastBufferedReaderTest {
private static Logger _logger = Logger.getLogger(FastBufferedReaderTest.class);
@Before
public void setUp() throws Exception {}
@After
public void tearDown() throws Exception {}
@Test
public void performanceOfCSVSplit() throws Exception {
StopWatch s = new StopWatch();
String line = null;
final int N = 1;
Pattern p = Pattern.compile(",");
s.reset();
for (int i = 0; i < N; i++) {
BufferedReader br =
new BufferedReader(
new InputStreamReader(
FileResource.find(SilkWalkerTest.class, "scaffold1.silk").openStream()));
while ((line = br.readLine()) != null) {
ArrayList<String> csv = StringUtil.splitCSV(line);
}
}
_logger.info("OpenCSV split:" + s.getElapsedTime());
}
@Test
public void performanceOfTabSplit() throws Exception {
StopWatch s = new StopWatch();
String line = null;
final int N = 1;
Pattern p = Pattern.compile("\t");
s.reset();
for (int i = 0; i < N; i++) {
BufferedReader br =
new BufferedReader(
new InputStreamReader(
FileResource.find(SilkWalkerTest.class, "scaffold1.silk").openStream()));
while ((line = br.readLine()) != null) {
String[] tab = p.split(line);
}
}
_logger.info("default tab split:" + s.getElapsedTime());
s.reset();
for (int i = 0; i < N; i++) {
BufferedReader br =
new BufferedReader(
new InputStreamReader(
FileResource.find(SilkWalkerTest.class, "scaffold1.silk").openStream()));
while ((line = br.readLine()) != null) {
ArrayList<String> tokens = StringUtil.splitAtTab(line);
}
}
_logger.info("my tab split:" + s.getElapsedTime());
s.reset();
for (int i = 0; i < N; i++) {
BufferedReader br =
new BufferedReader(
new InputStreamReader(
FileResource.find(SilkWalkerTest.class, "scaffold1.silk").openStream()));
while ((line = br.readLine()) != null) {
StringTokenizer t = new StringTokenizer(line, "\t");
ArrayList<String> tokens = new ArrayList<String>();
while (t.hasMoreTokens()) {
tokens.add(t.nextToken());
}
}
}
_logger.info("tokenizer tab split:" + s.getElapsedTime());
s.reset();
for (int i = 0; i < N; i++) {
FastBufferedReader fb =
new FastBufferedReader(
new InputStreamReader(
FileResource.find(SilkWalkerTest.class, "scaffold1.silk").openStream()));
while ((line = fb.readLine()) != null) {
ArrayList<String> tab = StringUtil.splitAtTab(line);
}
}
_logger.info("fast reader:" + s.getElapsedTime());
}
@Test
public void perfTest() throws Exception {
StopWatch s = new StopWatch();
File in = FileResource.copyToTemp(SilkWalkerTest.class, "scaffold1.silk", new File("target"));
final int N = 2;
{
s.reset();
int lineCount = 0;
char[] buf = new char[8192];
for (int i = 0; i < N; i++) {
BufferedReader fb = new BufferedReader(new FileReader(in));
for (int readSize = 0; (readSize = fb.read(buf)) != -1; ) {
for (int c = 0; c < readSize; c++) {
if (buf[c] == '\r') {
lineCount++;
if (c + 1 < readSize && buf[c + 1] == '\n') {
c++;
}
} else if (buf[c] == '\n') {
lineCount++;
}
}
}
}
_logger.info(String.format("BufferedReader: %.2f", s.getElapsedTime()));
}
{
s.reset();
int lineCount = 0;
for (int i = 0; i < N; i++) {
BufferedScanner fb = new BufferedScanner(new FileInputStream(in));
for (CharSequence line; (line = fb.nextLine()) != null; lineCount++) {}
}
_logger.info(
String.format("BufferedScanner nextLine: %.2f, line:%d", s.getElapsedTime(), lineCount));
}
{
s.reset();
int lineCount = 0;
for (int i = 0; i < N; i++) {
BufferedReader fb = new BufferedReader(new FileReader(in));
for (String line; (line = fb.readLine()) != null; lineCount++) {}
}
_logger.info(
String.format("BufferedReader readLine: %.2f, line:%d", s.getElapsedTime(), lineCount));
}
{
s.reset();
int lineCount = 0;
for (int i = 0; i < N; i++) {
BufferedScanner fb = new BufferedScanner(new FileInputStream(in));
for (CharSequence line; (line = fb.nextLine()) != null; lineCount++) {
String st = line.toString();
}
}
_logger.info(
String.format(
"BufferedScanner nextLine (with String conversion): %.2f, line:%d",
s.getElapsedTime(), lineCount));
}
{
s.reset();
int lineCount = 0;
for (int i = 0; i < N; i++) {
BufferedScanner fb = new BufferedScanner(new FileReader(in));
for (CharSequence line; (line = fb.nextLine()) != null; lineCount++) {}
}
_logger.info(
String.format(
"BufferedScanner nextLine with Reader input: %.2f, line:%d",
s.getElapsedTime(), lineCount));
}
{
s.reset();
int lineCount = 0;
char[] buf = new char[8192];
for (int i = 0; i < N; i++) {
FastBufferedReader fb = new FastBufferedReader(new FileReader(in));
for (int readSize = 0; (readSize = fb.read(buf)) != -1; ) {
for (int c = 0; c < readSize; c++) {
if (buf[c] == '\r') {
lineCount++;
if (c + 1 < readSize && buf[c + 1] == '\n') {
c++;
}
} else if (buf[c] == '\n') {
lineCount++;
}
}
}
}
_logger.info(String.format("FastBufferedReader: %.2f", s.getElapsedTime()));
}
{
s.reset();
int lineCount = 0;
byte[] buf = new byte[8192];
for (int i = 0; i < N; i++) {
FastBufferedInputStream fb = new FastBufferedInputStream(new FileInputStream(in));
for (int readSize = 0; (readSize = fb.read(buf)) != -1; ) {
for (int c = 0; c < readSize; c++) {
if (buf[c] == '\r') {
lineCount++;
if (c + 1 < readSize && buf[c + 1] == '\n') {
c++;
}
} else if (buf[c] == '\n') {
lineCount++;
}
}
}
}
_logger.info(String.format("FastBufferedInputStream: %.2f", s.getElapsedTime()));
}
{
s.reset();
int lineCount = 0;
byte[] buf = new byte[8192];
for (int i = 0; i < N; i++) {
BufferedInputStream fb = new BufferedInputStream(new FileInputStream(in));
for (int readSize = 0; (readSize = fb.read(buf)) != -1; ) {
for (int c = 0; c < readSize; c++) {
if (buf[c] == '\r') {
lineCount++;
if (c + 1 < readSize && buf[c + 1] == '\n') {
c++;
}
} else if (buf[c] == '\n') {
lineCount++;
}
}
}
}
_logger.info(String.format("BufferedInputStream: %.2f", s.getElapsedTime()));
}
}
}
@Test
public void performanceOfTabSplit() throws Exception {
StopWatch s = new StopWatch();
String line = null;
final int N = 1;
Pattern p = Pattern.compile("\t");
s.reset();
for (int i = 0; i < N; i++) {
BufferedReader br =
new BufferedReader(
new InputStreamReader(
FileResource.find(SilkWalkerTest.class, "scaffold1.silk").openStream()));
while ((line = br.readLine()) != null) {
String[] tab = p.split(line);
}
}
_logger.info("default tab split:" + s.getElapsedTime());
s.reset();
for (int i = 0; i < N; i++) {
BufferedReader br =
new BufferedReader(
new InputStreamReader(
FileResource.find(SilkWalkerTest.class, "scaffold1.silk").openStream()));
while ((line = br.readLine()) != null) {
ArrayList<String> tokens = StringUtil.splitAtTab(line);
}
}
_logger.info("my tab split:" + s.getElapsedTime());
s.reset();
for (int i = 0; i < N; i++) {
BufferedReader br =
new BufferedReader(
new InputStreamReader(
FileResource.find(SilkWalkerTest.class, "scaffold1.silk").openStream()));
while ((line = br.readLine()) != null) {
StringTokenizer t = new StringTokenizer(line, "\t");
ArrayList<String> tokens = new ArrayList<String>();
while (t.hasMoreTokens()) {
tokens.add(t.nextToken());
}
}
}
_logger.info("tokenizer tab split:" + s.getElapsedTime());
s.reset();
for (int i = 0; i < N; i++) {
FastBufferedReader fb =
new FastBufferedReader(
new InputStreamReader(
FileResource.find(SilkWalkerTest.class, "scaffold1.silk").openStream()));
while ((line = fb.readLine()) != null) {
ArrayList<String> tab = StringUtil.splitAtTab(line);
}
}
_logger.info("fast reader:" + s.getElapsedTime());
}
public void SAIS(LSeq SA) {
StopWatch timer = new StopWatch();
_logger.info("SAIS: N=" + SA.textSize());
// Determin T[N-1]'s LS-type
// T[i] is SType if T[i,_) < T[i+1,_)
// T[i] is LType if T[i,_) > T[i+1,_)
{
long i = 0;
for (; i < N; ++i) {
long x = T.lookup((N + i - 1) % N);
long y = T.lookup((N + i) % N);
if (x == y) continue;
if (x < y) {
LS.set(N - 1, SType);
break;
} else {
LS.set(N - 1, LType);
break;
}
}
if (i == N) {
// When T = AAAA... , etc.
LS.set(N - 1, LType);
}
}
// T[i] is SType if T[i] < T[i+1] or T[i] = T[i+1] and T[i+1] is S-type
// T[i] is LType if T[i] > T[i+1] or T[i] = T[i+1] and T[i+1] is L-type
// Set the LS type of each character
for (long i = N - 1; i > 0; --i) {
long x = T.lookup(i);
long y = T.lookup(i - 1);
if (x < y) LS.set(i - 1, LType);
else if (x > y) LS.set(i - 1, SType);
else LS.set(i - 1, LS.get(i));
}
// Initialize the buckets.
// A bucket is a container of the suffixes sharing the same first character
{
_logger.trace("Initialize the buckets");
Arrays.fill(bucketEnd, 0);
// Compute the size of each bucket
for (long i = 0; i < N; ++i) {
++bucketEnd[(int) T.lookup(i)];
}
// Accumulate the character counts. The bucketStart holds the pointers to beginning of the
// buckets in SA
for (int i = 1; i < bucketEnd.length; ++i) {
bucketEnd[i] += bucketEnd[i - 1];
}
_logger.trace("Done.");
}
// initialize the suffix array
for (long i = 0; i < N; ++i) SA.set(i, N);
// Step 1: reduce the problem by at least 1/2
// Sort all the S-substrings
// Find LMS characters
long[] cursorInBucket = Arrays.copyOf(bucketEnd, bucketEnd.length);
for (long i = 0; i < N; ++i) {
if (isLMS(i)) SA.set(--cursorInBucket[(int) T.lookup(i)], i);
}
// Induced sorting LMS prefixes
{
_logger.trace(String.format("[N=%,d] induceSA", SA.textSize()));
induceSA(SA);
_logger.trace("Done.");
}
int numLMS = 0;
// Compact all the sorted substrings into the first M items of SA
// 2*M must be not larger than N
for (long i = 0; i < N; ++i) {
long si = SA.lookup(i);
if (si != N && isLMS(si)) SA.set(numLMS++, si);
}
// Initialize the name array buffer
for (long i = numLMS; i < N; ++i) SA.set(i, N);
// Find the lexicographic names of the LMS substrings
_logger.trace("Sorting LMS substrings: N=" + SA.textSize());
int name = 1;
SA.set(numLMS + (SA.lookup(0) / 2), name++);
for (long i = 1; i < numLMS; ++i) {
final long prev = SA.lookup(i - 1);
final long current = SA.lookup(i);
if (!isEqualLMSSubstring(prev, current)) {
name++;
}
SA.set(numLMS + (current / 2), name - 1);
}
for (long i = N - 1, j = N - 1; i >= numLMS; --i) {
if (SA.lookup(i) != N) SA.set(j--, SA.lookup(i) - 1);
}
// Step 2: solve the reduced problem
// Create SA1, a view of SA[0, numLMS-1]
_logger.trace("Solving the reduced problem: N=" + SA.textSize());
LSeq SA1 = new ArrayWrap(SA, 0, numLMS);
LSeq T1 = new ArrayWrap(SA, N - numLMS, numLMS);
if (name - 1 != numLMS) {
new CyclicSAIS(T1, name - 1).SAIS(SA1);
} else {
// When all LMS substrings have unique names
for (long i = 0; i < numLMS; i++) SA1.set(T1.lookup(i), i);
}
// Step 3: Induce SA from SA1
// Construct P1 using T1 buffer
for (long i = 0, j = 0; i < N; ++i) {
if (isLMS(i)) T1.set(j++, i); //
}
// Translate short name into the original index at T
// SA1 now holds the LMS-substring indexes
for (long i = 0; i < numLMS; ++i) {
SA1.set(i, T1.lookup(SA1.lookup(i)));
}
// Step 3-1: Put all the items in SA1 into corresponding S-type buckets of SA
// Clear SA[N1 .. N-1]
for (long i = numLMS; i < N; ++i) {
SA.set(i, N);
}
// Put SA1 contents into S-type buckets of SA
System.arraycopy(bucketEnd, 0, cursorInBucket, 0, bucketEnd.length);
for (int i = numLMS - 1; i >= 0; --i) {
long si = SA1.lookup(i);
SA.set(i, N);
long index = --cursorInBucket[(int) T.lookup(si)];
SA.set(index, si);
}
// SA.set(0, T.textSize() - 1);
// Step 3-2, 3-3
_logger.trace("Inducing SA from SA1: N=" + SA.textSize());
induceSA(SA);
_logger.info(String.format("done. %.2f sec.", timer.getElapsedTime()));
}
public class SmithWatermanAlignerTest {
private static Logger _logger = Logger.getLogger(SmithWatermanAlignerTest.class);
public Alignment bandedAlign(String ref, String query) throws Exception {
ACGTSequence r = new ACGTSequence(ref);
ACGTSequence q = new ACGTSequence(query);
Alignment alignment = SmithWatermanAligner.bandedAlign(r, q);
_logger.debug(alignment);
return alignment;
}
public Alignment bandedAlign(String ref, String query, AlignmentScoreConfig config)
throws Exception {
ACGTSequence r = new ACGTSequence(ref);
ACGTSequence q = new ACGTSequence(query);
Alignment alignment = SmithWatermanAligner.bandedAlign(r, q, config);
_logger.debug(alignment);
return alignment;
}
@Test
public void align() throws Exception {
Alignment alignment = bandedAlign("GATATAGAGATCTGGCCTAG", "TAGAGAT");
assertEquals("7M", alignment.cigar.toString());
assertEquals(4, alignment.pos);
assertEquals(0, alignment.numMismatches);
}
@Test
public void alignMismatch() throws Exception {
Alignment alignment = bandedAlign("GATATAGAGATCTGGCCTAG", "TATACAGATCTGGCCTAG");
assertEquals("4M1X13M", alignment.cigar.toString());
assertEquals(2, alignment.pos);
assertEquals(1, alignment.numMismatches);
}
@Test
public void alignInsertion() throws Exception {
AlignmentScoreConfig config = new AlignmentScoreConfig();
config.gapOpenPenalty = 5;
config.gapExtensionPenalty = 2;
Alignment alignment =
bandedAlign(
"TATACCAAGATATAGATCTGGCAAGTGTGTTAT", "TACCAAGATATAGAGATCTGGCAAGTGTGTTAT", config);
assertEquals("11M2I20M", alignment.cigar.toString());
assertEquals(2, alignment.pos);
assertEquals(2, alignment.numMismatches);
}
@Test
public void alignDeletion() throws Exception {
AlignmentScoreConfig config = new AlignmentScoreConfig();
config.gapOpenPenalty = 5;
config.gapExtensionPenalty = 2;
Alignment alignment =
bandedAlign(
"TATACCAAGATATAGAGATCTGGCAAGTGTGTTAT", "TACCAAGATATAGATCTGGCAAGTGTGTTAT", config);
assertEquals("11M2D20M", alignment.cigar.toString());
assertEquals(2, alignment.pos);
assertEquals(2, alignment.numMismatches);
}
@Test
public void clippedAlignment() throws Exception {
Alignment alignment = bandedAlign("ATTTGTATTATACCAAGAT", "ACCGGAAGGACCAAGAT");
assertEquals("9S8M", alignment.cigar.toString());
assertEquals(11, alignment.pos);
assertEquals(0, alignment.numMismatches);
}
}
public void addRelation(Relation relation) {
_logger.debug("add relation: " + relation.toString());
}
/**
* Suffix-array (SA) construction algorithm based on Induced Sorting (IS)
*
* @author leo
*/
public class CyclicSAIS {
private final LSeq T;
private final long N;
private final int K;
private final long[] bucketEnd;
private LSType LS;
private static final boolean LType = false;
private static final boolean SType = true;
public static class LSType {
private static final int BIT_LENGTH = 32;
private int[] bitVector;
private long size;
public LSType(long n) {
int blockSize = (int) ((n + BIT_LENGTH - 1) / BIT_LENGTH);
bitVector = new int[blockSize];
this.size = n;
}
public void set(long index, boolean flag) {
int pos = (int) (index / BIT_LENGTH);
int offset = (int) (index % BIT_LENGTH);
int mask = 0x01 << (offset - 1);
if (flag) bitVector[pos] |= mask;
else bitVector[pos] &= ~mask;
}
public boolean get(long index) {
int pos = (int) (index / BIT_LENGTH);
int offset = (int) (index % BIT_LENGTH);
int mask = 0x01 << (offset - 1);
return (bitVector[pos] & mask) != 0;
}
@Override
public boolean equals(Object obj) {
if (!BitVector.class.isInstance(obj)) return false;
LSType other = LSType.class.cast(obj);
// compare the size
if (size() != other.size()) return false;
// compare each byte
int byteLength = byteLength();
for (int i = 0; i < byteLength; i++) {
if (this.bitVector[i] != other.bitVector[i]) return false;
}
return true;
}
private int byteLength() {
return (int) ((size + BIT_LENGTH - 1) / BIT_LENGTH);
}
@Override
public int hashCode() {
int hashValue = 3;
int byteLength = byteLength();
for (int i = 0; i < byteLength; i++) {
hashValue += hashValue * 137 + bitVector[i];
}
return hashValue % 1987;
}
public long size() {
return size;
}
public void clear() {
bitVector = null;
size = 0;
}
@Override
public String toString() {
StringBuilder buf = new StringBuilder();
for (int i = 0; i < size; i++) buf.append(get(i) ? "1" : "0");
return buf.toString();
}
}
static class ArrayWrap implements LSeq {
private final LSeq seq;
private final long offset;
private final long length;
public ArrayWrap(LSeq original, long offset) {
this.seq = original;
this.offset = offset;
this.length = original.textSize() - offset;
}
public ArrayWrap(LSeq original, long offset, long length) {
this.seq = original;
this.offset = offset;
this.length = length;
}
@Override
public long lookup(long index) {
return seq.lookup(index + offset);
}
@Override
public long textSize() {
return length;
}
@Override
public void set(long index, long value) {
seq.set(index + offset, value);
}
@Override
public long increment(long index, long value) {
return seq.increment(index + offset, value);
}
@Override
public String toString() {
StringBuilder w = new StringBuilder();
w.append("[");
for (long i = 0; i < length; ++i) {
if (i != 0) w.append(", ");
w.append(lookup(i));
}
w.append("]");
return w.toString();
}
}
public CyclicSAIS(LSeq T, int K) {
this.T = T;
this.N = T.textSize();
this.K = K;
this.bucketEnd = new long[K];
LS = new LSType(N);
}
public static LSeq SAIS(LSeq T, int K) {
LSeq SA;
if (T.textSize() < Integer.MAX_VALUE) SA = new LSAIS.IntArray(new int[(int) T.textSize()], 0);
else if (T.textSize() < Math.pow(2, 32)) {
SA = new UInt32Array(T.textSize());
} else if (T.textSize() < Math.pow(2, 39)) {
SA = new Int40Array(T.textSize());
} else throw new IllegalArgumentException("Cannot create SA array more than 3.2GB length");
SAIS(T, SA, K);
return SA;
}
public static LSeq SAIS(LSeq T, LSeq SA, int K) {
CyclicSAIS sais = new CyclicSAIS(T, K);
sais.SAIS(SA);
return SA;
}
private static Logger _logger = Logger.getLogger(CyclicSAIS.class);
public void SAIS(LSeq SA) {
StopWatch timer = new StopWatch();
_logger.info("SAIS: N=" + SA.textSize());
// Determin T[N-1]'s LS-type
// T[i] is SType if T[i,_) < T[i+1,_)
// T[i] is LType if T[i,_) > T[i+1,_)
{
long i = 0;
for (; i < N; ++i) {
long x = T.lookup((N + i - 1) % N);
long y = T.lookup((N + i) % N);
if (x == y) continue;
if (x < y) {
LS.set(N - 1, SType);
break;
} else {
LS.set(N - 1, LType);
break;
}
}
if (i == N) {
// When T = AAAA... , etc.
LS.set(N - 1, LType);
}
}
// T[i] is SType if T[i] < T[i+1] or T[i] = T[i+1] and T[i+1] is S-type
// T[i] is LType if T[i] > T[i+1] or T[i] = T[i+1] and T[i+1] is L-type
// Set the LS type of each character
for (long i = N - 1; i > 0; --i) {
long x = T.lookup(i);
long y = T.lookup(i - 1);
if (x < y) LS.set(i - 1, LType);
else if (x > y) LS.set(i - 1, SType);
else LS.set(i - 1, LS.get(i));
}
// Initialize the buckets.
// A bucket is a container of the suffixes sharing the same first character
{
_logger.trace("Initialize the buckets");
Arrays.fill(bucketEnd, 0);
// Compute the size of each bucket
for (long i = 0; i < N; ++i) {
++bucketEnd[(int) T.lookup(i)];
}
// Accumulate the character counts. The bucketStart holds the pointers to beginning of the
// buckets in SA
for (int i = 1; i < bucketEnd.length; ++i) {
bucketEnd[i] += bucketEnd[i - 1];
}
_logger.trace("Done.");
}
// initialize the suffix array
for (long i = 0; i < N; ++i) SA.set(i, N);
// Step 1: reduce the problem by at least 1/2
// Sort all the S-substrings
// Find LMS characters
long[] cursorInBucket = Arrays.copyOf(bucketEnd, bucketEnd.length);
for (long i = 0; i < N; ++i) {
if (isLMS(i)) SA.set(--cursorInBucket[(int) T.lookup(i)], i);
}
// Induced sorting LMS prefixes
{
_logger.trace(String.format("[N=%,d] induceSA", SA.textSize()));
induceSA(SA);
_logger.trace("Done.");
}
int numLMS = 0;
// Compact all the sorted substrings into the first M items of SA
// 2*M must be not larger than N
for (long i = 0; i < N; ++i) {
long si = SA.lookup(i);
if (si != N && isLMS(si)) SA.set(numLMS++, si);
}
// Initialize the name array buffer
for (long i = numLMS; i < N; ++i) SA.set(i, N);
// Find the lexicographic names of the LMS substrings
_logger.trace("Sorting LMS substrings: N=" + SA.textSize());
int name = 1;
SA.set(numLMS + (SA.lookup(0) / 2), name++);
for (long i = 1; i < numLMS; ++i) {
final long prev = SA.lookup(i - 1);
final long current = SA.lookup(i);
if (!isEqualLMSSubstring(prev, current)) {
name++;
}
SA.set(numLMS + (current / 2), name - 1);
}
for (long i = N - 1, j = N - 1; i >= numLMS; --i) {
if (SA.lookup(i) != N) SA.set(j--, SA.lookup(i) - 1);
}
// Step 2: solve the reduced problem
// Create SA1, a view of SA[0, numLMS-1]
_logger.trace("Solving the reduced problem: N=" + SA.textSize());
LSeq SA1 = new ArrayWrap(SA, 0, numLMS);
LSeq T1 = new ArrayWrap(SA, N - numLMS, numLMS);
if (name - 1 != numLMS) {
new CyclicSAIS(T1, name - 1).SAIS(SA1);
} else {
// When all LMS substrings have unique names
for (long i = 0; i < numLMS; i++) SA1.set(T1.lookup(i), i);
}
// Step 3: Induce SA from SA1
// Construct P1 using T1 buffer
for (long i = 0, j = 0; i < N; ++i) {
if (isLMS(i)) T1.set(j++, i); //
}
// Translate short name into the original index at T
// SA1 now holds the LMS-substring indexes
for (long i = 0; i < numLMS; ++i) {
SA1.set(i, T1.lookup(SA1.lookup(i)));
}
// Step 3-1: Put all the items in SA1 into corresponding S-type buckets of SA
// Clear SA[N1 .. N-1]
for (long i = numLMS; i < N; ++i) {
SA.set(i, N);
}
// Put SA1 contents into S-type buckets of SA
System.arraycopy(bucketEnd, 0, cursorInBucket, 0, bucketEnd.length);
for (int i = numLMS - 1; i >= 0; --i) {
long si = SA1.lookup(i);
SA.set(i, N);
long index = --cursorInBucket[(int) T.lookup(si)];
SA.set(index, si);
}
// SA.set(0, T.textSize() - 1);
// Step 3-2, 3-3
_logger.trace("Inducing SA from SA1: N=" + SA.textSize());
induceSA(SA);
_logger.info(String.format("done. %.2f sec.", timer.getElapsedTime()));
}
boolean isLMS(long pos) {
return LS.get(pos % N) == SType && LS.get((pos - 1 + N) % N) == LType;
}
private void induceSA(LSeq SA) {
long[] cursorInBucket = Arrays.copyOf(bucketEnd, bucketEnd.length);
// induce left
for (long i = 0; i < N; ++i) {
long si = SA.lookup(i);
if (si == N) continue;
si = (si - 1 + N) % N;
if (LS.get(si) == LType) SA.set(cursorInBucket[(int) T.lookup(si) - 1]++, si);
}
// induce right
System.arraycopy(bucketEnd, 0, cursorInBucket, 0, bucketEnd.length);
for (long i = N - 1; i >= 0; --i) {
long si = SA.lookup(i);
if (si == N) continue;
si = (si - 1 + N) % N;
if (LS.get(si) == SType) SA.set(--cursorInBucket[(int) T.lookup(si)], si);
}
}
boolean isEqualLMSSubstring(long pos1, long pos2) {
boolean prevLS = SType;
long offset = 0;
for (; offset < N; ++offset) {
long p1 = (pos1 + offset) % N;
long p2 = (pos2 + offset) % N;
if (T.lookup(p1) == T.lookup(p2) && LS.get(p1) == LS.get(p2)) {
if (prevLS == LType && LS.get(p1) == SType) return true; // equal LMS substring
prevLS = LS.get(p1);
continue;
} else return false;
}
return false;
}
}
/**
* A DataModel manages the graph structure of an ER-diagram.
*
* <p>person:(id, name, address) || author:(book_id, author_id) |* |1 book:(r2:id, r2:title) ||
* order:(id, book_id, customer_id, info) || customer:(id, name, address, phone)
*
* <p>query examples (person:name, book:title = "Gone with the wind")
*
* <p>(book:id = 10, customer:name, order:info)
*
* <p>select customer:id, customer:name, count(*) from (select customer left join order on
* customer:id = order:customer_id)
*
* <p>Multidimensional Hash Table can support this type of query?
*
* @author leo
*/
public class DataModel {
private static Logger _logger = Logger.getLogger(DataModel.class);
private AdjacencyList<String, Relationship> _graph = new AdjacencyList<String, Relationship>();
public void addNode(String nodeName) {
if (!contains(nodeName)) _graph.addNode(nodeName);
}
public boolean contains(String nodeName) {
return _graph.hasNode(nodeName);
}
public void connectNodes(String sourceNodeName, String destNodeName, Relationship rel)
throws DBException {
_graph.addEdge(sourceNodeName, destNodeName, rel);
}
public Set<String> getRootNodeNameSet() {
TreeSet<String> rootNodeSet = new TreeSet<String>();
for (String node : _graph.getNodeLabelSet()) {
// if this node has no incoming edges
if (_graph.getInEdgeSet(node).size() == 0) rootNodeSet.add(node);
}
return rootNodeSet;
}
@SuppressWarnings("unchecked")
public List<String> destinationOf(String nodeName) {
Collection<Integer> nodeIDSet = _graph.getDestNodeIDSetOf(_graph.getNodeID(nodeName));
return CollectionUtil.collect(
nodeIDSet,
new Functor<Integer, String>() {
public String apply(Integer nodeID) {
return _graph.getNodeLabel(nodeID);
}
});
}
class PathSearch extends DepthFirstSearchBase<String, Relationship> {
public List<String> getPath(String src, String dest) {
run(_graph, src);
// TODO improve by using Dijkstra's algorithm
LinkedList<String> path = new LinkedList<String>();
path.add(dest);
String predecessor;
String contextNode = dest;
while (!(predecessor = getPredecessor(contextNode)).equals(contextNode)) {
path.addFirst(predecessor);
if (predecessor.equals(src)) {
return path;
}
contextNode = predecessor;
}
if (!path.getFirst().equals(src)) return new LinkedList<String>();
return path;
}
}
public List<String> path(String src, String dest) {
return new PathSearch().getPath(src, dest);
}
public boolean hasPath(String src, String dest) {
return path(src, dest).size() > 0;
}
public void save(SQLiteAccess query) throws DBException {
if (query.hasTable("node")) query.dropTable("node");
if (query.hasTable("edge")) query.dropTable("edge");
Relation nodeRelation = new Relation();
nodeRelation.add(new DataTypeBase("id", TypeName.INTEGER, true, true));
nodeRelation.add(new DataTypeBase("name", TypeName.STRING));
query.createTable("node", nodeRelation);
Relation edgeRelation = new Relation();
edgeRelation.add(new DataTypeBase("id", TypeName.INTEGER, true, true));
edgeRelation.add(new DataTypeBase("src", TypeName.INTEGER));
edgeRelation.add(new DataTypeBase("dest", TypeName.INTEGER));
edgeRelation.add(new DataTypeBase("relationship", TypeName.INTEGER));
query.createTable("edge", edgeRelation);
Vector<NodeData> nodeList = new Vector<NodeData>();
for (int nodeID : _graph.getNodeIDSet()) {
nodeList.add(new NodeData(nodeID, _graph.getNodeLabel(nodeID)));
}
Vector<EdgeData> edgeList = new Vector<EdgeData>();
for (Edge edge : _graph.getEdgeSet()) {
edgeList.add(
new EdgeData(
_graph.getEdgeID(edge),
edge.getSourceNodeID(),
edge.getDestNodeID(),
_graph.getEdgeLabel(edge)));
}
for (NodeData node : nodeList) query.insert("node", node);
for (EdgeData edge : edgeList) query.insert("edge", edge);
}
public void load(SQLiteAccess query) throws DBException {
TreeSet<NodeData> nodeList = CollectionUtil.sort(query.amoebaQuery(NodeData.class, "node"));
TreeSet<EdgeData> edgeList = CollectionUtil.sort(query.amoebaQuery(EdgeData.class, "edge"));
for (NodeData node : nodeList) {
_graph.addNode(node.getName());
}
for (EdgeData edge : edgeList) {
_graph.addEdge(
new Edge(edge.getSrc(), edge.getDest()), EdgeData.translate(edge.getRelationship()));
}
}
public String toString() {
return _graph.toString();
}
public void attachSQLiteDatabase(String sqliteDBFile) throws DBException {
SQLiteAccess query = new SQLiteAccess(sqliteDBFile);
Collection<String> tableList = query.getTableList();
List<String> infoTableList =
CollectionUtil.select(
tableList,
new Predicate<String>() {
public boolean apply(String input) {
return isInfoTable(input);
}
});
List<String> dataTableList =
CollectionUtil.select(
tableList,
new Predicate<String>() {
public boolean apply(String input) {
return !isInfoTable(input);
}
});
// HashMap<String, HashMap<String, String>>
for (String infoTable : infoTableList) {
for (DataModelInfo info : query.amoebaQuery(DataModelInfo.class, infoTable)) {}
}
for (String dataTable : dataTableList) {
Relation relation = new Relation();
for (SQLiteDataTypeInfo dataType : query.getSQLiteDataTypeInfo(dataTable)) {
relation.add(Relation.getDataType(dataType.getName(), dataType.getType()));
}
addRelation(relation);
}
}
public void addRelation(Relation relation) {
_logger.debug("add relation: " + relation.toString());
}
private static boolean isInfoTable(String tableName) {
return tableName.endsWith("_info");
}
public boolean hasEdge(String src, String dest) {
return _graph.hasEdge(src, dest);
}
public Relationship getRelationship(String src, String dest) {
return _graph.getEdgeLabel(src, dest);
}
}
/** Web action: ScaleBar */
public class ScaleBar extends WebTrackBase {
private static final long serialVersionUID = 1L;
private static Logger _logger = Logger.getLogger(ScaleBar.class);
/**
* Describe your web action parameters here. Public fields in this class will be set using the web
* request query parameters before calling handle().
*/
/**
* Predefined coordinate parameters for GenomeTrack. Uncomment the following lines if you want to
* receive these parameter values.
*/
// public String species; /* human, mouse, etc. */
// public String revision; /* hg19, mm9 ... */
// public String name; /* chr1, chr2, ... */
public long range;
public int width = 700; /* track pixel width */
public int height = 20;
private final int[] template = {5, 2, 1};
private BufferedImage image;
private Graphics2D g;
/** Use dbGroup, dbName parameters to specify database contents to be accessed */
// public String dbGroup; /* database group */
// public String dbName; /* database name in the group */
public ScaleBar() {}
@Override
public void handle(HttpServletRequest request, HttpServletResponse response)
throws ServletException, IOException {
// write your own code to generate an web page here.
image = new BufferedImage(width, height, BufferedImage.TYPE_INT_ARGB);
g = image.createGraphics();
draw();
response.setContentType("image/png");
ImageIO.write(image, "png", response.getOutputStream());
// Generate debug log messages. (log level: trace, debug, info, warn, error, fatal)
// You can switch log level by specifying -Dloglevel=debug in the eclipse launch file, or
// use -l (log level) option in the utgb command.
// _logger.debug("debug message");
}
private void draw() {
long half_range = range / 2;
int digit = Long.toString(half_range).length();
long unit = (long) Math.pow(10, digit - 1);
for (int i = 0; i < template.length; i++) {
if (half_range >= template[i] * unit) {
unit *= template[i];
break;
}
}
double ratio = (double) unit / (double) range / 2.0;
int x_left = (int) ((0.5 - ratio) * width + 0.5);
int x_right = (int) ((0.5 + ratio) * width + 0.5);
int x_1 = (int) ((0.5 - ratio * 0.8) * width + 0.5);
int x_2 = (int) ((0.5 - ratio * 0.6) * width + 0.5);
int x_3 = (int) ((0.5 - ratio * 0.4) * width + 0.5);
int x_4 = (int) ((0.5 - ratio * 0.2) * width + 0.5);
int x_c = (int) (0.5 * width + 0.5);
int x_6 = (int) ((0.5 + ratio * 0.2) * width + 0.5);
int x_7 = (int) ((0.5 + ratio * 0.4) * width + 0.5);
int x_8 = (int) ((0.5 + ratio * 0.6) * width + 0.5);
int x_9 = (int) ((0.5 + ratio * 0.8) * width + 0.5);
int y_lr_u = height * 7 / 20;
int y_lr_l = height * 13 / 20;
int y_c_u = height * 2 / 5;
int y_c_l = height * 3 / 5;
;
int y_o_u = height * 9 / 20;
;
int y_o_l = height * 11 / 20;
int unit_digit = Long.toString(unit).length();
int unit_remainder = (unit_digit - 1) % 3;
unit_remainder++;
int unit_quotient = (unit_digit - 1) / 3;
String suffix = "";
if (unit_quotient == 0) {
} else if (unit_quotient == 1) {
suffix = "k";
} else if (unit_quotient == 2) {
suffix = "M";
} else if (unit_quotient == 3) {
suffix = "G";
} else if (unit_quotient == 4) {
suffix = "T";
}
g.setColor(Color.BLACK);
g.drawLine(x_left, height / 2, x_right, height / 2);
g.drawLine(x_left, y_lr_u, x_left, y_lr_l);
g.drawLine(x_right, y_lr_u, x_right, y_lr_l);
g.drawLine(x_c, y_c_u, x_c, y_c_l);
g.drawLine(x_1, y_o_u, x_1, y_o_l);
g.drawLine(x_2, y_o_u, x_2, y_o_l);
g.drawLine(x_3, y_o_u, x_3, y_o_l);
g.drawLine(x_4, y_o_u, x_4, y_o_l);
g.drawLine(x_6, y_o_u, x_6, y_o_l);
g.drawLine(x_7, y_o_u, x_7, y_o_l);
g.drawLine(x_8, y_o_u, x_8, y_o_l);
g.drawLine(x_9, y_o_u, x_9, y_o_l);
Font f = new Font("SansSerif", Font.PLAIN, 10);
g.setFont(f);
g.drawString(
Long.toString(unit).substring(0, unit_remainder) + suffix + "b",
x_right + 5,
height / 2 + height / 15);
}
}
