private VariantContext getMatchingSnpEffRecord( List<VariantContext> snpEffRecords, VariantContext vc) { for (VariantContext snpEffRecord : snpEffRecords) { if (snpEffRecord.hasSameAlternateAllelesAs(vc) && snpEffRecord.getReference().equals(vc.getReference())) { return snpEffRecord; } } return null; }
private byte[] generateHaplotype( final List<VariantContext> sourceVCs, final ReferenceContext refContext) { final StringBuilder sb = new StringBuilder(); final int startPos = refContext.getWindow().getStart(); int currentPos = startPos; final byte[] reference = refContext.getBases(); for (final VariantContext vc : sourceVCs) { // add any missing reference context int vcStart = vc.getStart(); final int refAlleleLength = vc.getReference().length(); if (refAlleleLength == vc.getEnd() - vc.getStart()) // this is a deletion (whereas for other events the padding base // isn't part of the position) vcStart++; while (currentPos < vcStart) sb.append((char) reference[currentPos++ - startPos]); // add the alt allele sb.append(vc.getAlternateAllele(0).getBaseString()); // skip the reference allele currentPos += refAlleleLength; } // add any missing reference context final int stopPos = refContext.getWindow().getStop(); while (currentPos < stopPos) sb.append((char) reference[currentPos++ - startPos]); return sb.toString().getBytes(); }
@Override public void accumulate(final VariantContext ctx) { logger.record(ctx.getContig(), ctx.getStart()); final String variantChrom = ctx.getContig(); final int variantPos = ctx.getStart(); // Skip anything a little too funky if (ctx.isFiltered()) return; if (!ctx.isVariant()) return; if (SKIP_CHROMS.contains(variantChrom)) return; for (final MendelianViolationMetrics trio : trios) { final Genotype momGt = ctx.getGenotype(trio.MOTHER); final Genotype dadGt = ctx.getGenotype(trio.FATHER); final Genotype kidGt = ctx.getGenotype(trio.OFFSPRING); // if any genotype: // - has a non-snp allele; or // - lacks a reference allele // // then ignore this trio if (CollectionUtil.makeList(momGt, dadGt, kidGt) .stream() .anyMatch( gt -> gt.isHetNonRef() || Stream.concat(Stream.of(ctx.getReference()), gt.getAlleles().stream()) .anyMatch(a -> a.length() != 1 || a.isSymbolic()))) { continue; } // if between the trio there are more than 2 alleles including the reference, continue if (Stream.concat( Collections.singleton(ctx.getReference()).stream(), CollectionUtil.makeList(momGt, dadGt, kidGt) .stream() .flatMap(gt -> gt.getAlleles().stream())) .collect(Collectors.toSet()) .size() > 2) continue; // Test to make sure: // 1) That the site is in fact variant in the trio // 2) that the offspring doesn't have a really wacky het allele balance if (!isVariant(momGt, dadGt, kidGt)) continue; if (kidGt.isHet()) { final int[] ad = kidGt.getAD(); if (ad == null) continue; final List<Integer> adOfAlleles = kidGt .getAlleles() .stream() .map(a -> ad[ctx.getAlleleIndex(a)]) .collect(Collectors.toList()); final double minAlleleFraction = Math.min(adOfAlleles.get(0), adOfAlleles.get(1)) / (double) (adOfAlleles.get(0) + adOfAlleles.get(1)); if (minAlleleFraction < MIN_HET_FRACTION) continue; } /////////////////////////////////////////////////////////////// // Determine whether the offspring should be haploid at this // locus and which is the parental donor of the haploid genotype /////////////////////////////////////////////////////////////// boolean haploid = false; Genotype haploidParentalGenotype = null; if (FEMALE_CHROMS.contains(variantChrom) && trio.OFFSPRING_SEX != Sex.Unknown) { if (trio.OFFSPRING_SEX == Sex.Female) { // famale haploid = false; } else if (isInPseudoAutosomalRegion(variantChrom, variantPos)) { // male but in PAR on X, so diploid haploid = false; } else { // male, out of PAR on X, haploid haploid = true; haploidParentalGenotype = momGt; } } // the PAR on the male chromosome should be masked so that reads // align to the female chromosomes instead, so there's no point // of worrying about that here. if (MALE_CHROMS.contains(variantChrom)) { if (trio.OFFSPRING_SEX == Sex.Male) { haploid = true; haploidParentalGenotype = dadGt; } else { continue; } } // We only want to look at sites where we have high enough confidence that the genotypes we // are looking at are // interesting. We want to ensure that parents are always GQ>=MIN_GQ, and that the kid is // either GQ>=MIN_GQ or in the // case where kid is het that the phred-scaled-likelihood of being reference is >=MIN_GQ. if (haploid && (haploidParentalGenotype.isNoCall() || haploidParentalGenotype.getGQ() < MIN_GQ)) continue; if (!haploid && (momGt.isNoCall() || momGt.getGQ() < MIN_GQ || dadGt.isNoCall() || dadGt.getGQ() < MIN_GQ)) continue; if (kidGt.isNoCall()) continue; if (momGt.isHomRef() && dadGt.isHomRef() && !kidGt.isHomRef()) { if (kidGt.getPL()[0] < MIN_GQ) continue; } else if (kidGt.getGQ() < MIN_GQ) continue; // Also filter on the DP for each of the samples - it's possible to miss hets when DP is too // low if (haploid && (kidGt.getDP() < MIN_DP || haploidParentalGenotype.getDP() < MIN_DP)) continue; if (!haploid && (kidGt.getDP() < MIN_DP || momGt.getDP() < MIN_DP || dadGt.getDP() < MIN_DP)) continue; trio.NUM_VARIANT_SITES++; /////////////////////////////////////////////////////////////// // First test for haploid violations /////////////////////////////////////////////////////////////// MendelianViolation type = null; if (haploid) { if (kidGt.isHet()) continue; // Should not see heterozygous calls at haploid regions if (!haploidParentalGenotype.getAlleles().contains(kidGt.getAllele(0))) { if (kidGt.isHomRef()) { type = MendelianViolation.Haploid_Other; trio.NUM_HAPLOID_OTHER++; } else { type = MendelianViolation.Haploid_Denovo; trio.NUM_HAPLOID_DENOVO++; } } } /////////////////////////////////////////////////////////////// // Then test for diploid mendelian violations /////////////////////////////////////////////////////////////// else if (isMendelianViolation(momGt, dadGt, kidGt)) { if (momGt.isHomRef() && dadGt.isHomRef() && !kidGt.isHomRef()) { trio.NUM_DIPLOID_DENOVO++; type = MendelianViolation.Diploid_Denovo; } else if (momGt.isHomVar() && dadGt.isHomVar() && kidGt.isHet()) { trio.NUM_HOMVAR_HOMVAR_HET++; type = MendelianViolation.HomVar_HomVar_Het; } else if (kidGt.isHom() && ((momGt.isHomRef() && dadGt.isHomVar()) || (momGt.isHomVar() && dadGt.isHomRef()))) { trio.NUM_HOMREF_HOMVAR_HOM++; type = MendelianViolation.HomRef_HomVar_Hom; } else if (kidGt.isHom() && ((momGt.isHom() && dadGt.isHet()) || (momGt.isHet() && dadGt.isHom()))) { trio.NUM_HOM_HET_HOM++; type = MendelianViolation.Hom_Het_Hom; } else { trio.NUM_OTHER++; type = MendelianViolation.Other; } } // Output a record into the family's violation VCF if (type != null) { // Create a new Context subsetted to the three samples final VariantContextBuilder builder = new VariantContextBuilder(ctx); builder.genotypes( ctx.getGenotypes() .subsetToSamples(CollectionUtil.makeSet(trio.MOTHER, trio.FATHER, trio.OFFSPRING))); builder.attribute(MENDELIAN_VIOLATION_KEY, type.name()); // Copy over some useful attributes from the full context if (ctx.hasAttribute(VCFConstants.ALLELE_COUNT_KEY)) builder.attribute(ORIGINAL_AC, ctx.getAttribute(VCFConstants.ALLELE_COUNT_KEY)); if (ctx.hasAttribute(VCFConstants.ALLELE_FREQUENCY_KEY)) builder.attribute(ORIGINAL_AF, ctx.getAttribute(VCFConstants.ALLELE_FREQUENCY_KEY)); if (ctx.hasAttribute(VCFConstants.ALLELE_NUMBER_KEY)) builder.attribute(ORIGINAL_AN, ctx.getAttribute(VCFConstants.ALLELE_NUMBER_KEY)); // Write out the variant record familyToViolations.get(trio.FAMILY_ID).add(builder.make()); } } }
@Override public void runCommand() { logger.info("MergeVCFColumnsCommand"); /* * Assumptions * (1) Only two vcfs that are sorted with the same contig order * (2) if contigs on it same order, then we will just skip that contig * (3) No overlapping samples allowed * * Output: * A vcf where intersecting sites are merged together and will only return biallelic markers * the info field will be cleared * the only GT FORMAT field will be there */ Collection<File> vcfs = applicationOptions.getVcfs(); String outfile = applicationOptions.getOutFile(); if (vcfs.size() != 2) { throw new IllegalArgumentException("This function requires exactly two vcfs"); } Iterator<File> vcfFileIter = vcfs.iterator(); File vcf1 = vcfFileIter.next(); File vcf2 = vcfFileIter.next(); VCFFileReader reader1 = new VCFFileReader(vcf1, false); VCFFileReader reader2 = new VCFFileReader(vcf2, false); Iterator<VariantContext> iter1 = reader1.iterator(); Iterator<VariantContext> iter2 = reader2.iterator(); VariantContextComparator comparator = new VariantContextComparator(); /* * Merge headers */ VCFHeader header1 = reader1.getFileHeader(); VCFHeader header2 = reader2.getFileHeader(); List<String> samples1 = header1.getGenotypeSamples(); List<String> samples2 = header2.getGenotypeSamples(); List<String> mergedSamples = new ArrayList<>(samples1.size() + samples2.size()); mergedSamples.addAll(samples1); mergedSamples.addAll(samples2); // Validate that there are no duplicates HashSet<String> sampleSet = new HashSet<String>(); for (String id : mergedSamples) { if (sampleSet.contains(id)) { throw new IllegalArgumentException("Duplicate id found: " + id); } else { sampleSet.add(id); } } HashSet<VCFHeaderLine> meta = new HashSet<>(); meta.add(new VCFFormatHeaderLine("GT", 1, VCFHeaderLineType.String, "GT")); meta.addAll(header1.getContigLines()); VCFHeader mergedHeader = new VCFHeader(meta, mergedSamples); /* * Create encoder */ VCFEncoder encoder = new VCFEncoder(mergedHeader, false, false); BufferedWriter writer = null; try { if (outfile.endsWith(".gz")) { BlockCompressedOutputStream outstream = new BlockCompressedOutputStream(new File(outfile)); writer = new BufferedWriter(new OutputStreamWriter(outstream)); } else { writer = Files.newBufferedWriter( Paths.get(outfile), Charset.defaultCharset(), StandardOpenOption.CREATE, StandardOpenOption.TRUNCATE_EXISTING); } /* * Write header */ VCFHeaderWriter.writeHeader(writer, mergedHeader); logger.info("Wrote header"); VariantContext previous1 = null; VariantContext previous2 = null; int count = 0; int countFile1 = 0; int countFile2 = 0; boolean usePrevious1 = false; boolean usePrevious2 = false; while (iter1.hasNext() || iter2.hasNext()) { if ((iter1.hasNext() || usePrevious1) && (iter2.hasNext() || usePrevious2)) { VariantContext variant1 = null; VariantContext variant2 = null; // if(usePrevious1 == true && usePrevious2 == true && // comparator.compare(previous1,previous2) != 0) { // //then skip both // usePrevious1 = false; // usePrevious2 = false; // } if (usePrevious1) { variant1 = previous1; } else { variant1 = iter1.next(); countFile1++; } if (usePrevious2) { variant2 = previous2; } else { variant2 = iter2.next(); countFile2++; } // check that variants are ordered correctly if (previous1 != null && previous1 != variant1 && comparator.compare(previous1, variant1) > 0) { throw new IllegalStateException( previous1.getContig() + ":" + previous1.getStart() + " > " + variant1.getContig() + ":" + variant1.getStart()); } if (previous2 != null && previous2 != variant2 && comparator.compare(previous2, variant2) > 0) { throw new IllegalStateException( previous2.getContig() + ":" + previous2.getStart() + " > " + variant2.getContig() + ":" + variant2.getStart()); } int cmp = comparator.compare(variant1, variant2); if (cmp < 0) { // logger.info("Skipping VCF1: " + variant1.getContig() + ":" + variant1.getStart() + // "\t" + variant1.getReference().toString() + "\t" + variant1.getAlternateAlleles()); if (usePrevious1 == true && usePrevious2 == true) { // variant1 < variant2 // we need to go to next variant in vcf1 usePrevious1 = false; } usePrevious2 = true; } else if (cmp > 0) { if (usePrevious1 == true && usePrevious2 == true) { // variant1 > variant2 // we need to go to next variant in vcf2 usePrevious2 = false; } usePrevious1 = true; // logger.info("Skipping VCF2: " + variant2.getContig() + ":" + variant2.getStart() + // "\t" + variant2.getReference().toString() + "\t" + variant2.getAlternateAlleles()); } else { // they equal position usePrevious1 = false; usePrevious2 = false; if (variant1.isBiallelic() && variant2.isBiallelic() && variant1.getReference().equals(variant2.getReference()) && variant1.getAlternateAllele(0).equals(variant2.getAlternateAllele(0))) { // TODO: Finish merging // both variants are bialleleic and the reference and alternative alleles match count++; if (count % 10000 == 0) { logger.info(count + " mergeable variants found"); } VariantContext merged = VariantContextMerger.merge(variant1, variant2); writer.write(encoder.encode(merged)); writer.write("\n"); } else { // skip if they do not equal // logger.info("Skipping: " + variant1.getContig() + ":" + variant1.getStart() + // "\t" + variant1.getReference().toString() + "\t" + // variant1.getAlternateAlleles()); // logger.info("Skipping: " + variant2.getContig() + ":" + variant2.getStart() + // "\t" + variant2.getReference().toString() + "\t" + // variant2.getAlternateAlleles()); } } previous1 = variant1; previous2 = variant2; } else if (iter1.hasNext()) { // just skip remaining variants VariantContext current = iter1.next(); countFile1++; if (previous1 != null && current != null && comparator.compare(previous1, current) > 0) { throw new IllegalStateException( previous1.getContig() + ":" + previous1.getStart() + " > " + current.getContig() + ":" + current.getStart()); } previous1 = current; // logger.info("Skipping: " + previous1.getContig() + ":" + previous1.getStart() + "\t" + // previous1.getReference().toString() + "\t" + previous1.getAlternateAlleles()); } else if (iter2.hasNext()) { // just skip remaining variants // fixed bug/ was iter1 changed to iter2 VariantContext current = iter2.next(); countFile2++; if (previous2 != null && current != null && comparator.compare(previous2, current) > 0) { throw new IllegalStateException( previous2.getContig() + ":" + previous2.getStart() + " > " + current.getContig() + ":" + current.getStart()); } previous2 = current; // logger.info("Skipping: " + previous2.getContig() + ":" + previous2.getStart() + "\t" + // previous2.getReference().toString() + "\t" + previous2.getAlternateAlleles()); } else { throw new IllegalStateException("Error should not of reached this point"); } } reader1.close(); reader2.close(); logger.info(count + " merged variants"); logger.info(countFile1 + " variants in " + vcf1.getAbsolutePath()); logger.info(countFile2 + " variants in " + vcf2.getAbsolutePath()); } catch (Exception e) { e.printStackTrace(); } finally { if (writer != null) { try { logger.info("Flushing writer"); writer.close(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } } } logger.info("finished merging vcfs"); }
@Override protected void doWork(VcfIterator r, VariantContextWriter w) throws IOException { AbstractVCFCodec codeIn3 = VCFUtils.createDefaultVCFCodec(); String line; StringWriter sw = new StringWriter(); LOG.info("opening tabix file: " + this.TABIX); TabixReader tabix = new TabixReader(this.TABIX); while ((line = tabix.readLine()) != null) { if (!line.startsWith(VCFHeader.HEADER_INDICATOR)) { break; } sw.append(line).append("\n"); } VCFHeader header3 = (VCFHeader) codeIn3.readActualHeader( new LineIteratorImpl( LineReaderUtil.fromBufferedStream( new ByteArrayInputStream(sw.toString().getBytes())))); VCFHeader header1 = r.getHeader(); VCFHeader h2 = new VCFHeader(header1.getMetaDataInInputOrder(), header1.getSampleNamesInOrder()); for (String infoId : this.INFO_IDS) { VCFInfoHeaderLine vihl = header3.getInfoHeaderLine(infoId); if (vihl == null) { LOG.warn("Not INFO=" + infoId + " in " + TABIX); continue; } if (h2.getInfoHeaderLine(infoId) != null) { LOG.warn("Input already contains INFO=" + vihl); } h2.addMetaDataLine(vihl); } if (ALT_CONFLICT_FLAG != null) { h2.addMetaDataLine( new VCFInfoHeaderLine( ALT_CONFLICT_FLAG, 1, VCFHeaderLineType.Flag, "conflict ALT allele with " + this.TABIX)); } w.writeHeader(h2); while (r.hasNext()) { VariantContext ctx1 = r.next(); VariantContextBuilder vcb = new VariantContextBuilder(ctx1); String line2; String BEST_ID = null; boolean best_id_match_alt = false; List<VariantContext> variantsList = new ArrayList<VariantContext>(); int[] array = tabix.parseReg(ctx1.getChr() + ":" + (ctx1.getStart()) + "-" + (ctx1.getEnd())); TabixReader.Iterator iter = null; if (array != null && array.length == 3 && array[0] != -1 && array[1] >= 0 && array[2] >= 0) { iter = tabix.query(array[0], array[1], array[2]); } else { LOG.info("Cannot get " + ctx1.getChr() + ":" + (ctx1.getStart()) + "-" + (ctx1.getEnd())); } while (iter != null && (line2 = iter.next()) != null) { VariantContext ctx3 = codeIn3.decode(line2); if (ctx3.getStart() != ctx1.getStart()) continue; if (ctx3.getEnd() != ctx1.getEnd()) continue; if (ctx1.getReference().equals(ctx3.getReference()) && ctx1.getAlternateAlleles().equals(ctx3.getAlternateAlleles())) { variantsList.clear(); variantsList.add(ctx3); break; } else { variantsList.add(ctx3); } } for (VariantContext ctx3 : variantsList) { if (this.REF_ALLELE_MATTERS && !ctx1.getReference().equals(ctx3.getReference())) { continue; } if (this.ALT_ALLELES_MATTERS && !ctx1.getAlternateAlleles().equals(ctx3.getAlternateAlleles())) { continue; } if (ctx3.getID() != null && this.REPLACE_ID) { if (BEST_ID != null && best_id_match_alt) { // nothing } else { BEST_ID = ctx3.getID(); best_id_match_alt = ctx1.getAlternateAlleles().equals(ctx3.getAlternateAlleles()); } } for (String id : this.INFO_IDS) { Object info3 = ctx3.getAttribute(id); if (info3 == null) { continue; } Object info1 = ctx1.getAttribute(id); if (info1 != null && !this.REPLACE_INFO_FIELD) { continue; } vcb.attribute(id, info3); } if (ALT_CONFLICT_FLAG != null && !ctx1.getAlternateAlleles().equals(ctx3.getAlternateAlleles())) { vcb.attribute(ALT_CONFLICT_FLAG, true); } } if (BEST_ID != null) { vcb.id(BEST_ID); } w.add(vcb.make()); } tabix.close(); }
@Override protected void doWork(VcfIterator r, VariantContextWriter w) throws IOException { long nChanged = 0L; final String TAG = "INDELFIXED"; VCFHeader header = r.getHeader(); VCFHeader h2 = new VCFHeader(header.getMetaDataInInputOrder(), header.getSampleNamesInOrder()); h2.addMetaDataLine( new VCFInfoHeaderLine(TAG, 1, VCFHeaderLineType.String, "Fix Indels for @SolenaLS.")); w.writeHeader(h2); final Pattern dna = Pattern.compile("[ATGCatgc]+"); while (r.hasNext()) { VariantContext ctx = r.next(); VariantContextBuilder b = new VariantContextBuilder(ctx); List<Allele> alleles = ctx.getAlternateAlleles(); if (alleles.size() != 1 || !dna.matcher(ctx.getReference().getBaseString()).matches() || !dna.matcher(alleles.get(0).getBaseString()).matches()) { w.add(ctx); continue; } StringBuffer ref = new StringBuffer(ctx.getReference().getBaseString().toUpperCase()); StringBuffer alt = new StringBuffer(alleles.get(0).getBaseString().toUpperCase()); int start = ctx.getStart(); int end = ctx.getEnd(); boolean changed = false; /** ** we trim on the right side *** */ // REF=TGCTGCGGGGGCCGCTGCGGGGG ALT=TGCTGCGGGGG while (alt.length() > 1 && alt.length() < ref.length() && ref.charAt(ref.length() - 1) == alt.charAt(alt.length() - 1)) { changed = true; ref.setLength(ref.length() - 1); alt.deleteCharAt(alt.length() - 1); end--; } // REF=TGCTGCGGGGG ALT= TGCTGCGGGGGCCGCTGCGGGGG while (ref.length() > 1 && alt.length() > ref.length() && ref.charAt(ref.length() - 1) == alt.charAt(alt.length() - 1)) { changed = true; ref.setLength(ref.length() - 1); alt.deleteCharAt(alt.length() - 1); end--; } /** ** we trim on the left side *** */ // REF=TGCTGCGGGGGCCGCTGCGGGGG ALT=TGCTGCGGGGG while (alt.length() > 1 && alt.length() < ref.length() && ref.charAt(0) == alt.charAt(0)) { changed = true; ref.deleteCharAt(0); alt.deleteCharAt(0); start++; } // REF=TGCTGCGGGGG ALT= TGCTGCGGGGGCCGCTGCGGGGG while (ref.length() > 1 && alt.length() > ref.length() && ref.charAt(0) == alt.charAt(0)) { changed = true; ref.deleteCharAt(0); alt.deleteCharAt(0); start++; } if (!changed) { w.add(ctx); continue; } /* LOG.info(line); LOG.info("ctx.getStart() "+ctx.getStart()); LOG.info("ctx.getEnd() "+ ctx.getEnd()); LOG.info("start " + start); LOG.info("end "+end); LOG.info("ref " + ref.toString()); LOG.info("alt "+alt.toString()); */ Allele newRef = Allele.create(ref.toString(), true); Allele newAlt = Allele.create(alt.toString(), false); Allele newalleles[] = new Allele[] {newRef, newAlt}; b.attribute( TAG, ctx.getReference().getBaseString() + "|" + alleles.get(0).getBaseString() + "|" + ctx.getStart()); b.start(start); b.stop(end); b.alleles(Arrays.asList(newalleles)); nChanged++; VariantContext ctx2 = b.make(); try { w.add(ctx2); } catch (TribbleException err) { error(err, "Cannot convert new context:" + ctx2 + " old context:" + ctx); w.add(ctx); } } info("indels changed:" + nChanged); }